a CAAT box at 1886-1889, 225bp before the start codon; and a G box at 1911-1919 in the fragment, a 29 bp direct repeat unit was also found at 1251-1279,1295-1323. The sequence had the character of a plant promoter.
A new method is described for labelling of oligonucleotide piobe of HBV. The oligonucleotide is a 21-nucletide sequence 5' -(CTTCGCTTCACCTCTGCACGT). It is complementary to a region near the end of single-stranded gap of HBV and contains the direct repeat (DR) sequence (underlined). The oligonucleotide was labelled with Biotin-11-dUTP by TdT.
However,defected HIV 1 genomes of variable size were extensively detected in PBMCs of 9/10 HIV 1 infected persons. Using oligonucleotide probes the frequency of deletions was found to increase with their proximity to the center of the HIV 1 genome. Short direct repeat of three or four nucleotides was present at the deletion junctions in analyzing further detail;
The sequence analysis indicated that the integrate sites of prophages 933v and 933w Located at 2966137 and 1330826, respectively. There were 20bp and 7bp direct repeat sequences flanking the prophages 933v and 933w. The flanking repeat sequences are termed as attachment sites (attL and attR).
The genetic diversity of Mycobacterium tuberculosis strains in Thailand studied by amplification of DNA segments containing direct repetitive sequences
(1) the amino acid change in ORF Ⅵ was about 16%, considerably higher than that occured in other coding regions and that observed among the other three isolates; ( 2 ) an insertion of 39 bp at amino-proximal region of ORF Ⅳ, its Sequence was almost the same as that of the target region;
Binding of GCNF to the consensus element TCA[AG(G/T)TCA]2 (conRE), to the direct repeat DNA element AGGTCAAGGTCA (DR0), and to extended half-sites such as TCAAGGTCA (XRE) has been demonstrated, but no natural GCNF target gene has been identified.
The 3' end of atp9-3 gene is flanked by a direct repeat of 42 bp.
ISRm31 is 2,803?bp long and has 22-bp-long terminal inverted repeat sequences, 8-bp direct repeat sequences generated by transposition, and three ORFs (A, B, C) coding for proteins of 124, 115, and 541 amino acids, respectively.
Furthermore, deletion mapping and mutational analysis of the stbD promoter region were used to identify a degenerated direct repeat motif required for STP induced GusA expression.
However, DNA sequence analysis suggested that direct repeat-rich sites could have promoted several recombination events to diversify the two plasmid molecules.
The complete nucleotide sequence of CaMV-XJ genomic DNA has been determined by Maxam-Gilbert chemical cleavage method from a clone pCaMV Cl7 which contains the full-length viral DNA copy.The entire sequence is 8060 base-pair long. There are six major open reading frames ( ORF)or putative genes in CaMV genome using different reading frames.In comparison with other three completely sequenced CaMV isolates, the following marked differences were observed;(1) the amino acid change in ORF Ⅵ was about 16%, considerably...
The complete nucleotide sequence of CaMV-XJ genomic DNA has been determined by Maxam-Gilbert chemical cleavage method from a clone pCaMV Cl7 which contains the full-length viral DNA copy.The entire sequence is 8060 base-pair long. There are six major open reading frames ( ORF)or putative genes in CaMV genome using different reading frames.In comparison with other three completely sequenced CaMV isolates, the following marked differences were observed;(1) the amino acid change in ORF Ⅵ was about 16%, considerably higher than that occured in other coding regions and that observed among the other three isolates; ( 2 ) an insertion of 39 bp at amino-proximal region of ORF Ⅳ, its Sequence was almost the same as that of the target region; ( 3 ) introduction of two in-phase termi-n ation codons in ORF Ⅷ suggested by T.Hohn which made it imposs be to code for a functional protein.
A new method is described for labelling of oligonucleotide piobe of HBV. The oligonucleotide is a 21-nucletide sequence 5' -(CTTCGCTTCACCTCTGCACGT). It is complementary to a region near the end of single-stranded gap of HBV and contains the direct repeat (DR) sequence (underlined). The oligonucleotide was labelled with Biotin-11-dUTP by TdT.The results revealed that after 2 hours incubation the labelling efficiency is the highest. The polymerization in the presence of 1 mM Cobalt ion is better than the polymerization...
A new method is described for labelling of oligonucleotide piobe of HBV. The oligonucleotide is a 21-nucletide sequence 5' -(CTTCGCTTCACCTCTGCACGT). It is complementary to a region near the end of single-stranded gap of HBV and contains the direct repeat (DR) sequence (underlined). The oligonucleotide was labelled with Biotin-11-dUTP by TdT.The results revealed that after 2 hours incubation the labelling efficiency is the highest. The polymerization in the presence of 1 mM Cobalt ion is better than the polymerization in the presence of 10 mM Cobalt ion or 10 mM Magnesium ion. The polymerization in the presence of dNTP is better than the polymerization in the absence of dNTP. When Biotin-11-dUTP is replaced by Biotin-7-dATP, the efficiency of labelling decreases.For colour development, we use two methods. The sensitivity of detection by preformed Streptavidin-Al kaline phosphatase complex is higher than the sensitivity of detection by adding the Streptavidin and Biotinated alkaline phospatase in series.Using this Biotinated oligonucleotide probe, we can detect as little as 25 Pg of standard HBV DNA. HBV DNA can also be detected in sera of Hepatitis B patients by dot-blot hybridization.
The present experiment was designed to observe the genetic variation of equine infectious anemia virus (EIAV) envelop gp 90 gene in infected horse. One horse was infected experimentally with P337V70 strain and showed no clinical signs after being infected at twice with the same virus strain. Seventeen proviral sequences covering principal neutralizing domain (PND) of EIAV gp 90 gene were obtained from the buffy coat and liver of the horse through PCR amplification and cloning. Comparative analysis of the sequences...
The present experiment was designed to observe the genetic variation of equine infectious anemia virus (EIAV) envelop gp 90 gene in infected horse. One horse was infected experimentally with P337V70 strain and showed no clinical signs after being infected at twice with the same virus strain. Seventeen proviral sequences covering principal neutralizing domain (PND) of EIAV gp 90 gene were obtained from the buffy coat and liver of the horse through PCR amplification and cloning. Comparative analysis of the sequences revealed that some sequences contained the nucleotide insertions in the PND region. The insertions might be generated by direct repeat and strand displacement of sequence segment in their PND gene, showing different lenghts.
直接重复
direct repeat
查询“直接重复”译词为用户自定义的双语例句
相关查询
2008 CNKI－中国知网